Genetic variation of chloroplast DNA in Zingiberaceae taxa from Myanmar assessed by PCR–restriction fragment length polymorphism analysis

RESEARCH ARTICLE Genetic variation of chloroplast DNA in Zingiberaceae taxa from Myanmar assessed by PCR–restriction fragment length polymorphism analysis D. Ahmad1,2, A. Kikuchi1, S.A. Jatoi1,3, M. Mimura1 & K.N. Watanabe1 1 Gene Research Center, Graduate School of Life and Environmental Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki, Japan 2 Institute of Biotechnology and Genetic Engineering (IBGE), NWFP Agricultural University, Peshawar, Pakistan 3 Plant Genetic Resources Program, National Agricultural Research Center, Islamabad, Pakistan Keywords cpDNA; interspecific; Myanmar; PCR–RFLP; Zingiberaceae. Correspondence K.N. Watanabe, Gene Research Center, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8572, Japan. Email: [email protected] Received: 7 July 2008; revised version accepted: 9 January 2008. doi:10.1111/j.1744-7348.2009.00322.x Abstract We examined genetic variation in 22 accessions belonging to 11 species in four genera of the Zingiberaceae, mainly from Myanmar, by PCR–restriction frag- ment length polymorphism analysis to investigate their relationships within this family. Two of 10 chloroplast gene regions (trnS-trnfM and trnK2–trnQr) showed differential PCR amplification across the taxa. Restriction enzyme digestion of the PCR products revealed interspecific variability. The restriction patterns were used to classify the regions as either highly conserved or variable across the taxa. None of the regions was highly conserved across the four genera, and the level of conservation varied. The gene region trnS-trnfM appeared to display interspecific variability among most of the species. However, the rela- tive efficiency of different restriction enzymes depended on the gene regions and genera investigated. Cluster analysis revealed interspecific discrimination among the taxa. The two Curcuma species (Curcuma zedoaria and Curcuma xan- thorrhiza) appeared to be identical, thus supporting their recent classification as synonyms. The results provide the basis for selecting specific combinations of restriction enzymes and gene regions of chloroplast DNA (cpDNA) to iden- tify interspecific variation in the Zingiberaceae and to identify both highly conserved and variable regions. Overall, cpDNA depicted comparatively diverse genetic profile of the studied germplasm. The genetic information re- vealed here can be applied to the conservation and future breeding of Zingiber and Curcuma species. Introduction The collection and evaluation of indigenous plant genetic resources from different agro-climatic conditions is essen- tial to identifying potential germplasm for improving breeding programmes and for introducing lines into non-traditional areas (Garg et al., 1999). The Union of Myanmar, a Southeast Asian country located in a mon- soon area, is an unexplored country rich in plant genetic resources (San-San-Yi et al., 2008). Several studies have documented the high level of genetic diversity in different crops from Myanmar, including rice (Yamanaka et al., 2004), tomato (San-San-Yi et al., 2008), banana (Wan et al., 2005) and members of the Zingiberaceae (Jatoi et al., 2006). Apart from the unique geographical location and favourable climatic conditions, another reason for the unique crop diversity found here is the var- iation in traditional cultivation methods in different re- gions because of the rich cultural diversity (San-San-Yi et al., 2008). The Zingiberaceae, the largest family of the order Zingiberales, consists of many medicinally important and Annals of Applied Biology ISSN 0003-4746 Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists 91 spice-producing aromatic perennial herbs, notably ginger and turmeric. The family has 53 genera and more than 1200 species distributed throughout Asia, Africa and the Pacific islands (Kress et al., 2002; Jatoi et al., 2007). Tropical Asia, including Myanmar, is one of the main centres of the Zingiberaceae owing to its moist, swampy, hot climatic conditions and its diversity of habitats (Ravindran et al., 2005; Jatoi et al., 2007). Advances in molecular phylogenetics have highlighted the importance of the chloroplast genome for the purpose of investigating the evolutionary relationships among diverse crop taxa through the use of specific coding and non-coding regions of chloroplast DNA (cpDNA) (Taberlet et al., 1991; Demesure et al., 1995; Dumolin-Lapegue et al., 1997). However, subsequent studies have also documented the use of the chloroplast genome for stud- ies of genetic diversity in various plant species. Interspe- cific polymorphisms have been reported in the cpDNA of nine Abies species and seven crucifier species (Parducci & Szmidt, 1999; Claudia et al., 2004), and intrageneric vari- ation has been reported in the cpDNA of 24 mangrove species belonging to 17 genera, and in seven millet species belonging to five genera (Parani et al., 2000, 2001). Intraspecific chloroplast genome variation has been documented in Quercus robur, Fagus sylvatica, Dicor- ynia guianensis and Abies alba (Dumolin et al., 1995; Zie- genhagen et al., 1995; Demesure et al., 1996). Wei et al. (2005) found both chloroplast genome variations among different species (interspecific) and within the same spe- cies (intraspecific) of the genus Houttuynia. Genetic vari- ation in the chloroplast genome has also been used in intergeneric studies of Cajanus (Lakshmi et al., 2000). In the Zingiberaceae, cpDNA has been used mainly for phylogenetic studies. Kress et al. (2002) proposed a new classification of the Zingiberaceae using matK and inter- nal transcribed spacer (ITS) gene regions. The phylog- eny of Thai Boesenbergia was also examined by using the petA–psbJ spacer of cpDNA (Ngamriabsakul & Techaprasan, 2006). The plastid matK gene region and the nuclear ITS sequences were used to further clarify the molecular phylogeny of Alpinia (Kress et al., 2005). Cao et al. (2001) used 18S rRNA gene and trnK gene sequences to identify Chinese and Japanese Curcuma species. Smith et al. (1993) analysed sequences of the chloroplast-encoded rbcL gene to perform parsimony analysis of 21 species of the order Zingiberales. The trnL–trnF and ITS sequences revealed the phylogenetic position of Aulotandra (Harris et al., 2005). The studies conducted so far mainly address the evolutionary rela- tionships among different members of the Zingiber- aceae where only a few gene regions were analysed through sequence analysis. However, no attempts have been made to explore genetic variation in the chloro- plast genome of Zingiberaceae by digesting different gene regions with a range of restriction enzymes. Previously, our group used rice SSRs (simple sequence repeats) as RAPD (randomly amplified polymorphic DNA) markers in the Zingiberaceae and revealed that Myanmar germplasm had a highly diverse genetic profile (Jatoi et al., 2006). In further studies, we also found considerable genetic differences among representative Zingiberaceae accessions from Myanmar using neutral and functional nuclear genomic markers (Jatoi, 2008; Jatoi et al., 2008). The current study is an attempt to determine whether the highly diverse genetic profile shown by the Myanmar germplasm in our previous studies using nuclear genetic markers is also reflected by cpDNA, which is highly conserved in nature. The specific objective of the study was to evaluate the genetic variation among the four Zingiberaceae genera (intergeneric variation) and within the species of each genus (intrageneric variation) in the chloroplast genome and to study the genetic relationships among the Zingiberaceae germplasm. Materials and methods Plant materials We assayed 22 accessions representing 11 species in four genera of the Zingiberaceae: Zingiber officinale, Zingiber barbatum, Zingiber mioga; Curcuma amada, Curcuma longa, Curcuma aromatica, Curcuma zedoaria, Curcuma xanthor- rhiza; Kaempferia pandurata, Kaempferia galanga; Alpinia officinarum and two unidentified Alpinia species (Table 1). For the isolation of DNA, seed-rhizomes of the different species were planted in pots under glasshouse conditions in Tsukuba, Japan, at the end of March 2007. The num- ber of plants per accession ranged from 10 to 15 depend- ing on availability of rhizomes. Individual plants per pot were planted in non-replicated mode, and pots were placed on the shelves. The glasshouse temperature was maintained around 35�C on a 12-h daylight cycle. DNA isolation Total genomic DNA was extracted from fresh young leaves following the procedure described by Doyle & Doyle (1990) with slight modifications. The DNA was extracted on individual plant basis taking 10 plants per accession. The quality of the extracted DNA was checked by spec- trophotometer, while the concentration was determined by comparing band intensities of individual samples with a known concentration of lambda DNA in 1% agarose gels. DNA of each accession was further diluted to a final concentration of 25 ng lL21. The DNA from the 10 Genetic variation of cpDNA in Zingiberaceae D. Ahmad et al. 92 Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists plants was then pooled for PCR–restriction fragment length polymorphism (PCR–RFLP) analysis. PCR amplification Ten sets of cpDNA universal primers were tested for PCR amplification of cpDNA of 22 accessions (Table 2). PCR conditions were optimised to avoid low-level or non- specific amplification. All primer sets were synthesised by Operon Molecules for Life (Bothel, WA, USA). PCR am- plifications were performed in a 30-lL reaction volume containing 25 ng template DNA, 1.25 lL dNTPs (2.5 mM each), 0.5 lL (4 lM) of each reverse and forward primer, 2.5 lL (10�) ExTaq buffer and 0.2 lL (5 U lL21) Takara Taq DNA polymerase. Thermal cycling was performed in a Bio-Rad thermal cycler (Hercules, CA, USA) (Model: Icycler� Thermal Cycler). Thermal cycling conditions con- sisted of an initial denaturation for 2 min at 94�C fol- lowed by 40 cycles of 1 min denaturation at 94�C, 1 min annealing at 50–64�C (depending on the primer set; Table 2) and 3 min extension at 72�C. The final extension was carried out at 72�C for 10 min, and the reaction was held at 4�C. The optimal annealing temperatures of the primer sets trnT–trnF, trnQ–trnR and trnK2–trnQr were identified by testing a range of different temperatures for each primer pair using subsamples of material. The suc- cess of each PCR reaction was verified by electrophoresis of 3 lL of reaction products on 1% agarose gel in 0.5% tris-borate-EDTA (TBE) buffer followed by staining with ethidium bromide. Restriction analysis Nine restriction enzymes (AluI, BamHI, DraI, EcoRI, EcoRV, HaeIII, HinfI, RsaI and PstI), all commonly used in phylogeny studies, were used to digest the amplified products (Table 3). Both rare and frequent cutters were chosen from the literature. Each PCR product (3 lL) was digested with 10 U restriction endonuclease in a 10-lL reaction volume at 37�C for 2 h following the manu- facturer’s instructions. The digested DNA fragments were size fractionated by electrophoresis in 2–3% agarose gels in 0.5% TBE buffer or in 8% (29:1) polyacrylamide gels and then stained with ethidium bromide. Data analysis The digested DNA fragments were scored as present (1) or absent (0), and these data were used for statistical analy- ses. Genetic similarities among the accessions were deter- mined based on the Jaccard (1908) coefficients. Using the data matrix of similarity coefficients, we then con- structed a dendrogram using the unweighted pair-group method of the arithmetic average (UPGMA). The genetic similarities and dendrogram were computed using NTSYS-pc software (Rohlf, 2000). The statistical stability of the branches in the UPGMA dendrogram was tested by bootstrap analysis with 1000 replicates using Winboot Software (Yap & Nelson, 1996). An analysis of molecular variance (AMOVA; Excoffier et al., 1992) was performed to partition total genetic variation at intergeneric and in- trageneric levels using Arlequin version 3.1 software (Excoffier et al., 2005). Pair-wise squared Euclidean dis- tances between individuals were obtained to calculate variance components. For testing of significance, the number of permutations was set to 1000 following full permutation (Excoffier et al., 1992). Results PCR–restriction fragment length polymorphism profiles The PCR–RFLP analysis of the 10 chloroplast gene regions revealed differential amplification among the 22 taxa. Eight region-specific primer pairs each amplified a single fragment of similar size across the genera, but the two Table 1 List of Zingiberaceae species used in this study along with their codes, accession number, common name, botanical name and country of origin Codes Accession Numbers Botanical Name Common Name Country of Origin Zo1 ZO 4–1 Zingiber officinale Ginger Myanmar Zo2 ZO 5–1 Z. officinale Ginger Myanmar Zo3 ZO 20–1 Z. officinale Ginger Myanmar Zb1 ZO 63–1 Zingiber barbatum Wild ginger Myanmar Zb2 ZO 111 Z. barbatum Wild ginger Myanmar Zb3 ZO 113 Z. barbatum Wild ginger Myanmar Zm1 ZO 125 Zingiber mioga Myoga Japan Zm2 ZO 126 Z. mioga Myoga Japan Ca1 ZO 23–1 Curcuma amada Mango ginger Myanmar Ca2 ZO 43–1 C. amada Mango ginger Myanmar Ca3 ZO 45–1 C. amada Mango ginger Myanmar Cl1 ZO 130–1 Curcuma longa Turmeric Myanmar Cl2 ZO 131–1 C. longa Turmeric Myanmar Car1 ZO 135–1 Curcuma aromatica Wild turmeric Myanmar Car2 ZO 133–1 C. aromatica Wild turmeric Myanmar Cz ZO 132 Curcuma zedoaria Zedoary turmeric Japan Cx ZO 134 Curcuma xanthorrhiza Indian saffron Japan Kg ZO 61 Kaempferia galanga Lesser galangal Myanmar Kp ZO 122–1 Kaempferia pandurata Thai ginger Myanmar Ao ZO 74 Alpinia officinarum Chinese ginger Myanmar Alp1 ZO 93 Alpinia spp. Galangal Thailand Alp2 ZO 150 Alpinia spp. Galangal Myanmar D. Ahmad et al. Genetic variation of cpDNA in Zingiberaceae Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists 93 remaining primer pairs (trnS–trnfM and trnK2–trnQr) amplified fragments that differed in length across the genera. The amplified fragments ranged from 2962 bp for trnQ–trnR to 1286 bp for trnS–trnfM (Table 2). The amplified fragments were subsequently digested with different restriction enzymes revealing differential restriction profiles. DNA amplified with five primer pairs (trnT–trnF, trnH–trnK, trnS–trnfM, trnS–psbC and trnD– trnT) was digested with four enzymes (AluI, HaeIII, HinfI and RsaI); that amplified with three primer pairs (trnM– rbcL, trnQ–trnR and trnK2–trnQr) was digested with four enzymes (DraI, EcoRI, HinfI and HaeIII) and that ampli- fied with the remaining two primer pairs (trnK1–trnK2 and rbcL1–rbcL2) was digested with nine enzymes (AluI, BamHI, EcoRI, EcoRV, DraI, HinfI, HaeIII, PstI and RsaI). Most of the chloroplast gene regions showed restriction sites for all restriction enzymes used (Table 4). Gene region trnK1–trnK2 contained restriction sites for all en- zymes assayed, and gene region rbcL1–rbcL2 contained restriction sites for seven enzymes (Table 4). Four en- zymes were used for gene regions trnH–trnK, trnS–trnfM, trnS–psbC, trnD–trnT, trnQ–trnR and trnK2–trnQr; these six gene regions contained restriction sites for all of the enzymes used. Fig. 1 shows the amplified cpDNA of Table 3 Description of total number of bands and number of polymorphic bands produced by each restriction enzyme in a specific chloroplast DNA (cpDNA) region amplified with cpDNA specific primers Primer Pair/ cpDNA Region HinfI HaeIII AluI RsaI DraI EcoRI BamHI EcoRV Pst1 TB PB TB PB TB PB TB PB TB PB TB PB TB PB TB PB TB PB trnK1–trnK2 11 11 4 4 4 4 5 3 7 6 12 12 12 12 7 7 5 3 rbcL1–rbcL2 4 1 6 3 4 2 3 3 3 3 3 0 — — — — 3 0 trnH–trnK 5 3 6 4 6 2 6 6 x x x x x x x x x x trnS–trnfM 17 17 8 8 7 7 8 8 x x x x x x x x x x trnS–psbC 5 2 7 6 3 0 4 0 x x x x x x x x x x trnD–trnT 12 12 8 8 6 6 6 6 x x x x x x x x x x trnT–trnF 12 12 — — 5 5 5 5 x x X x x x x x x x trnM–rbcL 18 14 2 0 x x x x 9 9 — — x x x x x x trnQ–trnR 9 6 8 8 x x x x 12 12 13 13 x x x x x x trnK2–trnQr 8 5 4 4 x x x x 13 13 10 10 x x x x x x Total 101 83 53 45 35 26 37 31 44 43 38 35 12 12 7 7 8 3 PB, number of polymorphic bands; TB, total number of bands produced; x, enzymes not used for digestion; —, no digestion. Table 2 DNA sequences of the chloroplast DNA (cpDNA) primer pairs used in the current study along with their annealing temperatures and corre- sponding size of PCR products Primer Pairs/cp DNA Regions Primer Sequences Annealing Temperature (�C) Size (bp) Reference trnT–trnF 5#-CATTACAAATGCGATGCTCT-3#, 5#-ATTTGAACTGGTGACACGAG-3# 62.3 2011 Taberlet et al. (1991) trnH–trnK 5#-ACGGGAATTGAACCCGCGCA-3#, 5#-CCGACTAGTTCCGGGTTCGA-3# 62 1981 Demesure et al. (1995) trnS–trnfM 5#-GAGAGAGAGGGATTCGAACC-3#, 5#-CATAACCTTGAGGTCACGGG-3# 62 1286–1433 Demesure et al. (1995) trnK1–trnK2 5#-GGGTTGCCCGGGACTCGAAC-3#, 5#-CAACGGTAGAGTACTCGGCTTTTA-3# 53.5 2722 Demesure et al. (1995) trnS–psbC 5#-GGTTCGAATCCCTCTCTCTC-3#, 5#-GGTCGTGACCAAGAAACCAC-3# 57 1500 Demesure et al. (1995) trnD–trnT 5#- ACCAATTGAACTACAATCCC -3#, 5#- CTACCACTGAGTTAAAAGGG -3# 47.5 1500 Demesure et al. (1995) trnM–rbcL 5#-TGCTTTCATACGGCGGGAGT-3’, 5#- GCTTTAG#CTCTGTTTGTGG -3# 56.5 2882 Demesure et al. (1995) trnQ–trnR 5#-GGGACGGAAGGATTCGAACC-3#, 5#-ATTGCGTCCAATAGGATTTGAA-3# 62.3 2962 Dumolin-Lapegue et al. (1997) trnK2–trnQr 5#-TAAAAGCCGAGTACTCTACCGTTG-3#, 5#- CTATTCGGAGGTTCGAATCCTTCC -3# 62.3 2129–2962 Dumolin-Lapegue et al. (1997) rbcL1–rbcL2 5#-TGTCACCAAAAACAGAGACT-3#, 5#-TTCCATACTTCACAAGCAGC-3# 60 1451 Parani et al. (2000) Genetic variation of cpDNA in Zingiberaceae D. Ahmad et al. 94 Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists all 22 accessions for the gene region trnS–psbC and subsequently digested with HaeIII. PCR–RFLP of trnT– trnF and trnM–rbcL reveals restriction sites for three of four enzymes (Table 4). HaeIII and EcoRI failed to digest the PCR products for trnT–trnF and trnM–rbcL, respec- tively, and BamHI and EcoRV did not digest the PCR products for rbcL1–rbcL2. The frequent cutters (HinfI, HaeIII, AluI and RsaI) digested between one and eight restriction sites, whereas the rare cutters (DraI, EcoRI, BamHI, EcoRV and PstI) digested only one to three (Table 4). HinfI gave the highest number of restriction sites (8) when digesting the PCR products of trnK1–trnK2 and trnM–rbcL. Most of the PCR product/enzyme combi- nations allowed discrimination of genera, and some combinations also allowed discrimination between spe- cies (Table 5). The relative efficiency of the 9 restriction enzymes varied among the 10 regions assayed. HinfI digested all cpDNA regions at two to eight restriction sites (Table 4). By com- parison, HaeIII digested all regions except trnT–trnF, at one to five restriction sites. AluI, RsaI, DraI and PstI were as- sayed partially for some of the chloroplast gene regions demonstrating successful digestion and generation of var- iably sized fragments. EcoRI, EcoRV and BamHI were also used to assay selective cpDNA regions displaying varia- tions in the digestion profile with the number of restric- tion sites ranging from one to three (Table 4). Interspecific variability among the Zingiberaceae taxa The different combinations of cpDNA region and restriction enzymes provided informative genetic profiles of the Zingi- beraceae taxa (Table 5). The interspecific variability of dif- ferent Zingiber species was revealed by most of the cpDNA regions when digested with different restriction enzymes, and only rbcL1–rbcL2 gave a PCR product with the same restriction pattern with all enzymes in all Zingiber species (Table 5). The restriction profiles generated by the seven enzymes on trnK1–trnK2 in Zingiber species displayed interspecific variability and appeared to be highly variable in Zingiber species. Chloroplast gene regions trnS–trnfM and trnD–trnT also displayed variable restriction profiles across the different Zingiber species when digested with HinfI, HaeIII, AluI and RsaI. HinfI was the most informa- tive restriction enzyme for the determination of interspe- cific variability in Zingiber species: it digested six cpDNA gene regions displaying polymorphic restriction profiles. In order, the next most informative restriction enzymes were AluI, HaeIII, DraI, RsaI, EcoRI, EcoRV and PstI (Fig. 2). BamHI was used to digest trnK1–trnK2 and rbcL1– rbcL2 where similar digestion patterns were observed for these regions in Zingiber species.Ta b le 4 N u m b e r o f re st ri ct io n si te s a n d th e ra n g e o f si ze (b p ) p ro d u ce d b y d if fe re n t re st ri ct io n e n zy m e s in e a ch o f th e 1 0 ch lo ro p la st D N A (c p D N A ) re g io n s P ri m e r P a ir /c p D N A R e g io n H in fI H a e III A lu I R sa I D ra I E co R I B a m H I E co R V P st 1 R S S iz e (b p ) R S S iz e (b p ) R S S iz e (b p ) R S S iz e (b p ) R S S iz e (b p ) R S S iz e (b p ) R S S iz e (b p ) R S S iz e (b p ) R S S iz e (b p ) tr n K 1 – tr n K 2 8 7 0 0 – 2 5 1 2 2 0 0 – 5 0 0 3 1 0 0 0 – 3 3 0 1 1 7 0 0 – 9 5 0 1 1 5 0 0 – 1 4 0 0 2 1 8 0 0 – 3 5 0 3 1 3 0 0 – 3 3 0 1 1 8 0 0 – 1 0 6 0 1 1 6 0 0 – 1 1 0 0 rb cL 1 – rb cL 2 2 6 2 0 – 2 0 0 2 5 5 0 – 2 5 0 2 5 0 0 – 1 5 0 2 3 5 0 – 1 0 0 1 7 5 0 – 6 0 0 1 1 0 0 0 – 4 5 0 — — — — 2 7 2 0 – 7 0 0 tr n H – tr n K 2 1 1 0 0 – 2 5 0 3 1 0 0 0 – 1 0 0 5 5 7 5 – 5 0 2 1 3 0 0 – 3 5 0 x x x x x x x X x x tr n S – tr n fM 4 4 0 0 – 1 0 0 2 7 5 0 – 5 0 2 6 0 0 – 1 5 0 2 5 5 0 – 5 0 x x x x x x x X x x tr n S – p sb C 3 7 5 0 – 1 4 0 5 5 2 0 – 6 0 2 6 5 0 – 1 4 0 3 1 1 0 0 – 1 2 0 x x x x x x x X x x tr n D – tr n T 3 5 0 0 – 2 0 0 3 1 1 0 0 – 4 7 0 1 1 1 5 0 – 5 0 0 3 6 8 0 – 1 3 0 x x x x x x x X x x tr n T – tr n F 3 8 0 0 – 1 0 0 — — 1 1 2 7 5 – 7 5 0 2 1 3 0 0 – 2 0 0 x x x x x x x X x x tr n M – rb cL 8 6 5 0 – 8 0 1 2 0 0 0 – 9 5 0 x x x x 1 2 6 0 0 – 2 0 0 — — x x x X x x tr n Q – tr n R 4 7 5 0 – 2 2 0 1 2 0 0 0 – 1 8 0 0 x x x x 2 1 5 0 0 – 5 5 0 2 1 9 0 0 – 3 0 0 x x x X x x tr n K 2 – tr n Q r 6 6 1 0 – 3 0 1 1 3 0 0 – 1 0 0 0 x x x x 3 9 0 0 – 6 5 0 1 2 6 0 0 – 1 5 0 x x x x x x R S , re st ri ct io n si te s; x , e n zy m e s n o t u se d fo r d ig e st io n ; — , n o d ig e st io n . D. Ahmad et al. Genetic variation of cpDNA in Zingiberaceae Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists 95 The Curcuma species demonstrated interspecific varia- tion in the restriction profiles of five cpDNA gene regions (Table 5). The region trnS–trnfM was the most informa- tive gene region and gave a polymorphic restriction pro- file when digested with HinfI, AluI and RsaI. RsaI was the most informative enzyme for the determination of inter- specific variability in Curcuma species: it digested three cpDNA gene regions displaying polymorphic restriction profiles. In order, the next most informative restriction enzymes were HinfI, AluI and DraI (Fig. 2). The Kaempferia species demonstrated differential restriction profiles in seven cpDNA gene regions when digested with diverse restriction enzymes (Table 5). The region trnS–trnfM was the most informative region, dis- playing restriction sites for all tested enzymes and pro- vided a polymorphic restriction profile. HinfI was the most informative enzyme for the determination of inter- specific variability in Kaempferia species: it digested four cpDNA regions rendering polymorphic restriction pro- files. In order, the next most informative restriction en- zymes were HaeIII, AluI, DraI, EcoRI, RsaI and BamHI (Fig. 2). EcoRV and PstI were used to digest only trnK1– trnK2 and rbcL1–rbcL2 where similar digestion patterns were observed for these regions. The PCR–RFLP analysis revealed diverse interspecific var- iability in the 10 cpDNA regions of Alpinia species by dif- ferent restriction enzymes (Table 5). As in Kaempferia, HinfI was the most informative enzyme for the determina- tion of interspecific variability in Alpinia species: it digested seven cpDNA regions yielding polymorphic restriction pro- files. In order, the next most informative restriction enzymes were HaeIII, AluI, DraI, EcoRI and RsaI (Fig. 2). BamHI, EcoRV and PstI were used to digest only trnK1– trnK2 and rbcL1–rbcL2 where similar digestion patterns were observed for these regions (Table 5 and Fig. 2). Assessment of genetic relationships based on germplasm cpDNA variability The PCR–RFLP analysis resulted in 335 fragments, of which 285 (85%) were polymorphic across the 22 acces- sions. The genetic similarities derived from the Jaccard similarity coefficients were 0.747 in Zingiber, 0.694 in Curcuma, 0.657 in Kaempferia and 0.480 in Alpinia (Table 6). To gain a better insight into the genetic rela- tionships of the germplasm, we used cluster analysis to discriminate the accessions at intrageneric and interge- neric levels. The taxa were categorised into six clusters, where clusters I, II and III represented Z. officinale, Z. barbatum and Z. mioga, respectively, while clusters V and VI contained Kaempferia and Alpinia accessions, respec- tively (Fig. 3). One of the Alpinia spp. formed an opera- tional taxonomic unit, but at a longer distance it clustered with the other Alpinia species. Different Cur- cuma species comprised the major cluster, cluster IV, which was further resolved into subclusters. Within cluster IV, C. xanthorrhiza and C. zedoaria displayed com- plete identity with each other. One of the C. amada ac- cessions was grouped with C. longa. An AMOVA was performed to estimate the proportion of cpDNA variation observed at the intergeneric and intra- generic levels that detected significant variation among the Figure 1 PCR amplification and digestion pattern of 22 Zingiberaceae accessions (A) Chloroplast DNA amplified with the primer pair trnS-psbC (B) HaeIII digests of the same PCR products amplified with trnS-psbC. Each lane is represented by the accession number, DNA molecular weight marker (M) XIV (Roche) is loaded on both sides of the gel for size estimation. Genetic variation of cpDNA in Zingiberaceae D. Ahmad et al. 96 Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists species (Table 7). Of the total molecular variance, 42.01% was attributable to intrageneric variations and 57.99% to intergeneric variations (among the four genera). Discussion The current study documents the genetic variability and relationships among members of the Zingiberaceae taxa based on PCR–RFLP analysis of specific regions of the chloroplast genome with a diverse range of restriction en- zymes. This is the first report using a large number of gene regions, and enzyme combinations to analyse different genera of this family. We generated restriction profiles that provide diagnostic information for the determination of genetic relationships within this family. PCR–RFLP analysis revealed genetic variability within the cpDNA of Zingiberaceae germplasms. Among the different gene re- gions, trnK1–trnK2 had restriction sites for all of the en- zymes used displaying variable restriction profiles from the different enzymes in all species examined. Among the restriction enzymes, HinfI was the most useful because it digested all of the gene regions providing interspecific polymorphic restriction patterns for differ- ent genera. This result is consistent with those of other studies showing the suitability of HinfI for identifying genetic variability within the cpDNA of different species (Mohanty et al., 2000; Devos et al., 2003). The use of restriction enzymes recognising both 4-base and 6-base sequences provided important insight into the genetic structure of the Zingiberaceae at the species level that was reflected in the genetic similarities and grouping patterns of the different species. We found the concur- rent use of the frequent 4-base cutters and the relatively rare 6-base cutters more useful and informative of the genetic structure of the Zingiberaceae than using either type alone. One of our intentions was to investigate the genetic re- lationships between the 22 species on the basis of the restriction profiles of different enzymes. In the larger per- spective, the grouping pattern at the species and generic levels accorded with the current taxonomic classification. Genetic similarity is one of the measures to study genetic relatedness among diverse taxa (Yi et al., 1995; Sharma et al., 2001; Archana & Jawali, 2007). Analysis of genetic similarities among members of the Zingiberaceae reveal Zingiber, Curcuma and Kaempferia to be more closely related to each other than to Alpinia that formed a distant cluster. The former species belong to the tribe Zingiberae and latter to the Alpineae, which are the distant tribes in the family Zingiberaceae. The rela- tive closeness of the first three compared with Alpinia has been observed in other studies (Ngamriabsakul et al., 2004). This finding also supports the new molecular marker-based classification of the Zingiberaceae, as pro- posed by Kress et al. (2002). Curcuma amada in the current study was obtained from Myanmar, where it is predominantly found either wild or as garden planting. C. amada is popularly known as mango ginger owing to the mango-like aroma of its rhi- zome. Interestingly, more than one species of Curcuma have a mango-like aroma. For example, Curcuma sylvatica Table 5 Interspecific variability profile of Zingiberaceae species using 10 chloroplast DNA (cpDNA) regions Primer Pair/cp DNA Regions Genus Restriction Enzymes Hinf I Hae III Alu I RsaI Dra I Eco RI Bam HI Eco RV PstI trnK1– trnK2 Zingiber + 2 + + + + 2 + + Curcuma 2 2 2 2 2 2 2 2 2 Kaempferia + 2 2 2 2 2 + 2 2 Alpinia 2 2 2 2 2 + 2 2 2 rbcL1– rbcL2 Zingiber 2 2 2 2 2 2 2 2 2 Curcuma 2 2 2 2 2 2 2 2 2 Kaempferia 2 2 + 2 2 2 2 2 2 Alpinia + 2 + 2 2 2 2 2 2 trnT– trnF Zingiber + 2 + 2 x x x x x Curcuma + 2 2 2 x x x x x Kaempferia 2 2 2 2 x x x x x Alpinia + 2 + + x x x x x trnH– trnK Zingiber 2 2 + 2 x x x x x Curcuma 2 2 2 + x x x x x Kaempferia 2 + 2 2 x x x x x Alpinia + 2 2 2 x x x x x trnS– trnfM Zingiber + + + + x x x x x Curcuma + 2 + + x x x x x Kaempferia + + + + x x x x x Alpinia + + + + x x x x x trnS– psbC Zingiber 2 + 2 2 x x x x x Curcuma 2 2 2 2 x x x x x Kaempferia 2 2 2 2 x x x x x Alpinia + 2 2 2 x x x x x trnD– trnT Zingiber + + + + x x x x x Curcuma 2 2 2 + x x x x x Kaempferia + 2 2 2 x x x x x Alpinia 2 + 2 2 x x x x x trnM– rbcL Zingiber + 2 x x + 2 x x x Curcuma 2 2 x x 2 2 x x x Kaempferia 2 2 x x + 2 x x x Alpinia + 2 x x 2 2 x x x trnQ– trnR Zingiber 2 + x x + + x x x Curcuma 2 2 x x + 2 x x x Kaempferia + 2 x x 2 + x x x Alpinia 2 2 x x + 2 x x x trnK2– trnQr Zingiber + 2 x x + + x x x Curcuma 2 2 x x 2 2 x x x Kaempferia 2 2 x x + + x x x Alpinia + + x x + + x x x +, interspecific variability exists; 2, no interspecific variability; x, enzymes not used for digestion. D. Ahmad et al. Genetic variation of cpDNA in Zingiberaceae Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists 97 produces an aroma-like raw mango, and was previously reported as a separate species (Valeton, 1918), but is now considered as a variant of C. amada (Syamkumar & Sasikumar, 2007). The coexistence of such plants can mislead species identification. We found accessions of C. amada that were grouped into two different subclusters. This grouping is possibly the result of sampling adulter- ated plant material containing C. amada and its variants. Further studies with properly identified C. amada may resolve this issue. We found that C. zedoaria and C. xanthorrhiza were grouped together and were molecularly identical to each other. A high degree of similarity between these species at the morphological and the molecular levels (Liu & Wu, 1999; Syamkumar & Sasikumar, 2007) led to the revision of their status from different species to syno- nyms (Liu & Wu, 1999). The grouping of C. zedoaria and C. xanthorrhiza we observed supports those findings. Our results provide the basis for identifying specific en- zymes and cpDNA gene regions for the detection of inter- specific variability in the Zingiberaceae. We identified both highly conserved and variable regions within cpDNA across the 22 taxa. None of the regions was highly conserved across the four genera; for example, only rbcL1–rbcL2 was conserved in Zingiber species, whereas trnK1–trnK2, trnS–psbC, trnM–rbcL and trnK2–trnQr were conserved in addition to rbcL1–rbcL2 in Curcuma species. The cpDNA regions trnT–trnF and trnS–psbC were also conserved across the Kaempferia species. None of the regions was conserved across the Alpinia species. The chloroplast genome, being evolutionarily more highly conserved than nuclear DNA, shows little or no intra- specific variability in plants. However, despite the slow rate of genetic change in cpDNA (Palmer, 1987; Clegg et al., 1991), interspecific variation can be detected through restriction analysis of PCR-amplified cpDNA with specific universal primers (Dumolin et al., 1995; Ziegenhagen et al., 1995; Parani et al., 2001). Different studies have reported interspecific variation in cpDNA of many forest tree species (Ferris et al., 1993; Tsumura et al., 1994; Ziegenha- gen et al., 1995; Demesure et al., 1996; Dumolin-Lapegue et al., 1997). Our results also document interspecific and intergeneric genetic variability in cpDNA across Zingiber- aceae accessions. Many members of the Zingiberaceae are at an active stage of evolution (Sasikumar, 2005; Jatoi et al., 2007), and this may be reflected in the observed cpDNA variability. The major proportion of the germplasm we examined came from Myanmar and Thailand, which are rich in Zingiberaceae genetic resources and are believed to be the centre of origin of many such species. Our previous findings based on neutral and functional genomic markers also showed considerable genetic diversity in representative species of Zingiberaceae from Myanmar (Jatoi et al., 2006; Jatoi, 2008). 8 cp D N A re gi on s ( no .) HinfI HaeIII AluI RsaI DraI EcoRI BamHI EcoRV PstI 0 1 2 3 4 5 6 7 Alpinia Zingiber Kaempferia Curcuma Figure 2 Number of chloroplast DNA (cpDNA) gene regions in different Zingiberaceae taxa yielding a polymorphic restriction profile after digestion with a diverse range of restriction enzymes. Table 6 Genetic similarities based on Jaccard coefficients among Zingiberaceae species at the intrageneric and intergeneric level. The values in parenthesis are for the intrageneric level and averaged from similarity matrices of respective species in each genus Zingiber (0.658) Curcuma (0.678) Kaempferia (0.657) Alpinia (0.481) Zo Zb Zm Ca Cl Cz Car Cx Kg Kp Ao Alp1 Alp2 1.000 0.678 0.562 0.582 0.673 0.722 0.739 0.755 0.656 0.657 0.457 0.486 0.497 Zo, Zingiber officinale; Zb, Zingiber barbatum; Zm, Zingiber mioga; Ca, Curcuma amada; Cl, Curcuma longa; Cz, Curcuma zedoara; Car, Curcuma aromatica; Cx, Curcuma xanthorrhiza; Kg, Kaempferia galanga; Kp, Kaempferia pandurata; Ao, Alpinia officinarum and Alp1 and Alp2, Alpinia species. Genetic variation of cpDNA in Zingiberaceae D. Ahmad et al. 98 Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists We found PCR–RFLP analysis of cpDNA a reliable method to reveal genetic variations at the interspecific level in Zingiberaceae germplasms. Further studies using additional accessions representing more species from dif- ferent genera should contribute to our understanding of cpDNA variability, and ultimately form the basis for elu- cidating the phylogenetic relationships among the mem- bers of the Zingiberaceae and thus, determining the level of genetic variation available for conservation and improvement of these species. Acknowledgements This research work has been supported in part by the Peace Nakajima Foundation Japan (2007 grant). Germplasm was provided by Myanmar Agriculture Services, Ministry of Agriculture and Irrigation, Union of Myanmar based on Memorandum of Understanding and Material Transfer Agreement. We are also grateful to our colleagues Syed A. Gilani and Ryoko Hirano for their useful comments on the manuscript. References Archana V., Jawali N. (2007) Genetic variation and related- ness in Vigna unguiculata revealed by microsatellites. BARC Newsletter, 285,190–197. [WWW document]. URL http:// www.barc.ernet.in/publications/nl/2007/200710-28.pdf [accessed on 19 June 2008]. Cao H., Sasaki Y., Fushimi H., Komatsu K. (2001) Molecular analysis of medicinally used Chinese and Japanese Curcu- ma based on 18S rRNA and trnK gene sequences. Biological and Pharmaceutical Bulletin, 24, 1389–1394. Claudia C., Tonguc M., Griffiths P.D. (2004) Discrimination of diploid crucifer species using PCR-RFLP of chloroplast DNA. HortScience, 39, 1575–1577. Clegg M.T., Learn G.H., Golenberg E.M. (1991) Molecular evolution of chloroplast DNA. In Evolution at the Molecular Level. pp. 135–149. Eds R.K. Selander, A.G. Clark and T.S. Whittam. Sunderland, MA, USA: Sinauer Associates. Demesure B., Sodzi N., Petit R.J. (1995) A set of universal primers for amplification of polymorphic non-coding re- gions of mitochondrial and chloroplast DNA in plants. Molecular Ecology, 4, 129–134. Coefficient 0.45 0.59 0.86 1.00 Zm Cz Cx Kg Kp Ao Alp2 Alp1 I (Z. officinale) II (Z. barbatum) III(Z. mioga) 100.0 100.0 100.0 100.0 100.0 100.0 75.8 96.4 98.9 72.1 89.8 98.9 0.72 Zo1 Zb1 Zb2 Zb3 Zm2 Zo2 Zo3 Ca1 Cl1 Ca2 Cl2 Ca3 Car2 car1 IV(Curcuma) V(Kaempferia) VI(Alpinia) 81.1 90.5 87.6 99.4 81.7 Figure 3 Dendrogram based on 10 chloroplast DNA (cpDNA) primers, indicating the genetic diversity among the members of the family Zingiber- aceae. Zo, Zingiber officinale; Zb, Zingiber barbatum; Zm, Zingiber mioga; Ca, Curcuma amada; Cl, Curcuma longa; Cz, Curcuma zedoara; Car, Cur- cuma aromatica; Cx, Curcuma xanthorrhiza; Kg, Kaempferia galanga; Kp, Kaempferia pandurata; Ao, Alpinia officinarum and Alp1 and Alp2, unknown Alpinia species. The horizontal axis shows the genetic similarity coefficient (Jaccard, 1908). Roman numerals indicate six arbitrary cpDNA clusters. The arrow indicates one of Alpinia spp. (ZO 93) that made an operational taxonomic unit. The codes written against each bar correspond to the list given in Table 1. Table 7 Analysis ofmolecular variance based on amatrix of the presence or absence of restriction fragments. The significance testingwas based on 1000 permutations Source of Variation Degree of Freedom Sum of Squares Variance Components Percentage of Variation F-Value P-Value Intergeneric level 3 453.356 26.68141 57.99 0.579 0.0000 Intrageneric level 18 347.917 19.32870 42.01 Total 21 801.273 46.01011 D. Ahmad et al. Genetic variation of cpDNA in Zingiberaceae Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists 99 Demesure B., Comps B., Petit R.J. (1996) Chloroplast DNA phylogeography of the common beech (Fagus sylvatica L.) in Europe. Evolution, 50, 2515–2520. Devos N., Tyteca D., Raspe O., Wesselingh R.A., Jacquemart A.L. (2003) Patterns of chloroplast diversity among west- ern European Dactylorhiza species (Orchidaceae). Plant Sys- tematics and Evolution, 243, 85–97. Doyle J.J., Doyle J.L. (1990) A rapid total DNA preparation procedure for fresh plant tissue. Focus, 12, 13–15. Dumolin S., Demesure B., Petit R.J. (1995) Inheritance of chloroplast and mitochondrial genomes in pedunculate oak investigated with an efficient PCR method. Theoretical and Applied Genetics, 91, 1253–1256. Dumolin-Lapegue S., Pemonge M.H., Petit R.J. (1997) An enlarged set of consensus primers for the study of organ- elle DNA in plants. Molecular Ecology, 6, 393–397. Excoffier L., Smouse P., Quattro J.M. (1992) Analysis of molecular variance inferred from metric distances among DNA haplotypes: application to human mitochondrial DNA restriction data. Genetics, 131, 479–491. Excoffier L., Laval G., Schneider S. (2005) Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evolutionary Bioinformatics Online, 1, 47–50. Ferris C., Oliver R.P., Davy A.J., Hewitt G.M. (1993) Native oak chloroplasts reveal an ancient divide across Europe. Molecular Ecology, 2, 337–343. Garg S.N., Bansal R.P., Gupta M.M., Kumar S. (1999) Varia- tion in the rhizome essential oil and curcumin contents and oil quality in the land races of turmeric Curcuma longa of North Indian plains. Flavour and Fragrance Journal, 14, 315–318. Harris D.J., Newman M.F., Hollingsworth M.L., Mo¨ller M., Clark A. (2005) The phylogenetic position of Aulotandra (Zingiberaceae). Nordic Journal of Botany, 23, 725–734. Jaccard P. (1908) Nouvelles recherches sur la distribution florale. Bulletin de la Societe Vaudoise Sciences Nature, 44, 223–270. Jatoi S.A. (2008) Diversity on Zingiberaceae genetic resources with special reference to Myanmar. PhD Thesis. University of Tsukuba, Tsukuba. Jatoi S.A., Kikuchi A., San-San-Yi., Naing K.W., Yamanaka S., Watanabe J.A., Watanabe K.N. (2006) Use of rice SSR markers as RAPD markers for genetic diversity analysis in Zingiberaceae. Breeding Science, 56, 107–111. Jatoi S.A., Kikuchi A., Watanabe K.N. (2007) Genetic diversity, cytology, and systematic and phylogenetic studies in Zingiberaceae. Genes, Genomes and Genomics, 1, 56–62. Jatoi S.A., Kikuchi A., Mimura M., San-San-Yi., Watanabe K.N. (2008) Relationships of Zingiber species, and genetic variability assessment in ginger (Zingiber officinale) ac- cessions from ex situ genebank, on-farm and rural mar- kets. Breeding Science, 58, 261–270. Kress W.J., Prince L.M., Williams K.J. (2002) The phylogeny and a new classification of the gingers (Zingiberaceae): evidence from molecular data. American Journal of Botany, 89, 1682–1696. Kress W.J., Liu A.Z., Newman M., Li Q.J. (2005) The molec- ular phylogeny of Alpinia (Zingiberaceae): a complex and polyphyletic genus of gingers. American Journal of botany, 92, 167–178. Lakshmi M., Senthilkumar P., Parani M., Jithesh M.N., Parida A.K. (2000) PCR-RFLP analysis of chloroplast gene regions in Cajanus (Leguminosae) and allied genera. Eu- phytica, 116, 243–250. Liu N., Wu T.L. (1999) Notes on Curcuma in China. Journal of Tropical and Subtropical Botany, 7, 146–150. Mohanty A., Martin J.P., Aguinagalde I. (2000) Chloroplast DNA diversity within and among populations of the allo- tetraploid Prunus spinosa L. Theoretical and Applied Genetics, 100, 1304–1310. Ngamriabsakul C., Techaprasan J. (2006) The phylogeny of Thai Boesenbergia (Zingiberaceae) based on petA-psbJ spacer (chloroplast DNA). Songklanakarin Journal of Science Technology, 28, 49–57. Ngamriabsakul C., Newman M.F., Cronk Q.C. (2004) The phylogeny of tribe Zingibereae (Zingiberaceae) based on ITS (nrDNA) and trnL-F (cpDNA) sequences. Edinburgh Journal of Botany, 60, 483–507. Palmer J.D. (1987) Chloroplast DNA evolution and bio- systematic uses of chloroplast DNA variation. The American Naturalist, 130, S6–S29. Parani M., Lakshmi M., Ziegenhagen B., Fladung M., Senthilkumar P., Parida A. (2000) Molecular phylogeny of mangrove VII. PCR-RFLP of trnS-psbC and rbcL gene regions in 24 mangrove and mangrove associate-species. Theoretical and Applied Genetics, 100, 454–460. Parani M., Rajesh K., Lakshmi M., Parducci L., Szmidt A.E., Parida A. (2001) Species identification in seven small mil- let species using polymerase chain reaction—restriction fragment length polymorphism of trnS-psbC gene region. Genome, 44, 495–499. Parducci L., Szmidt A.E. (1999) PCR-RFLP analysis of cpDNA in the genus Abies. Theoretical and Applied Genetics, 98, 802–808. Ravindran P.N., Nirmal B.K., Shiva K.N. (2005) Botany and crop improvement of ginger. In Ginger: The Genus Zingiber. pp. 15–85. Eds P.N. Ravindran and B.K. Nirmal. New York, NY, USA: CRC Press. Rohlf F.J. (2000) NTSYS-pc: Numerical Taxonomy and Multivar- iate Analysis System, Version 2.1. New York, NY, USA: Exeter Software. San-San-Yi, Jatoi S.A., Fujimura T., Yamanaka S., Watanabe J., Watanabe K.N. (2008) Potential loss of unique genetic diversity in tomato landraces by genetic colonization of modern cultivars at a non-center of origin. Plant Breeding, 127, 189–196. Sasikumar B. (2005) Genetic resources of Curcuma: diversity, characterization and utilization. Plant Genetic Resources, 3, 230–251. Genetic variation of cpDNA in Zingiberaceae D. Ahmad et al. 100 Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists Sharma I.K., Jones D.L., Young A.G., French C.J. (2001) Genetic diversity and phylogenetic relatedness among six endemic Pterostylis species (Orchidaceae; series Grandiflorae) of Western Australia, as revealed by allozyme poly- morphisms. Biochemical Systematics and Ecology, 29, 697–710. Smith J.F., Kress W.J., Zimmer E.A. (1993) Phylogenetic analysis of the Zingiberales based on rbcL sequences. Annals of the Missouri Botanical Garden, 80, 620–630. Syamkumar S., Sasikumar B. (2007) Molecular marker based genetic diversity analysis of Curcuma species from India. Scientia Horticulturae, 112, 235–241. Taberlet P., Gielly L., Pautou G., Bouvet J. (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology, 17, 1105–1109. Tsumura Y., Taguchi H., Suyama Y., Ohba K. (1994) Geo- graphical cline of chloroplast DNA variation in Abies mar- iesii. Theoretical and Applied Genetics, 89, 922–926. Valeton T.H. (1918) New notes on the Zingiberaceae of Java and Malaya. Bulletin du Jardin Botanique de Buitenzorg Ser. II, 27, 1–8. Wan Y., Watanabe J.A., San-San-Yi, Than-Htaik, Khaw-Win, Yamanaka S., Nakamura I., Watanabe K.N. (2005) Assess- ment of genetic diversity among the major Myanmar banana landraces. Breeding Science, 55, 365–369. Wei W., Youliang Z., Li C., Yuming W., Zehong Y., Ruiwu Y. (2005) PCR-RFLP analysis of cpDNA and mtDNA in the genus Houttuynia in some areas of China. Hereditas, 142, 24–32. Yamanaka S., San-San-Yi, Kothari S.L., Tin-Htut, Watanabe K.N. (2004) Evaluation of genetic resources based on the diversity on functional regions IV. Features of Myanmar rice genetic resources based on PBAs, SSRs and agronomic traits. Breeding Research, 6(Suppl. 2), 361. Yap I.V., Nelson R.J. (1996) Winboot: A Program for Perform- ing Bootstrap Analysis of Binary Data to Determine the Confi- dence Limits of UPGMA-Based Dendrograms. Manila, Philippines: IRRI. Yi Q.M., Deng W.G., Xis Z.P., Pang H.H. (1995) Poly- morphism and genetic relatedness among wild and culti- vated rice species determined by AP-PCR analysis. Hereditas, 122, 135–141. Ziegenhagen B., Kormutak A., Schauerte M., Scholz F. (1995) Restriction-site polymorphism in chloroplast DNA of Silver Fir (Abies alba Mill.). Forest Genetics, 2, 99–107. D. Ahmad et al. Genetic variation of cpDNA in Zingiberaceae Ann Appl Biol 155 (2009) 91–101 ª 2009 The Authors Journal compilation ª 2009 Association of Applied Biologists 101