1 제 5 장 동물 분자육종을 위한 DNA 표지인자의 이용 전통적인 통계적 보정 방법에 의한 동물육종 DNA 상의 특성 및 유전자 조작에 의한 동물육종 동물육종 방법의 변화 ( 교재 133 참조 )

Slide 11 제 5 장 동물 분자육종을 위한 DNA 표지인자의 이용 전통적인 통계적 보정 방법에 의한 동물육종 DNA 상의 특성 및 유전자 조작에 의한 동물육종 동물육종 방법의 변화 ( 교재 133 참조 ) Slide 22 Molecular Methods for Identification of Genotypes Basic Concept The number of nucleic acid or amino acid differen ces between two organisms is proportional to the time since they diverged from a common ancesto r. TIME MOLECULAR DIFFERENCES 1 AAGGCTA 2 AAGGGTA 3 AAGGGTG Example Rate of Evolution = 1bp per 100 years 1 2 3 100years 200 years DNA 의 다형현상 Slide 33 MARKERS IN BIOLOGY Phenotypic markers = Naked eye markers P = E+G Flower colors, shape of pods, etc.. Slide 44 Differences can be detected: –Visually – morphological traits P1 F1P2 B. Vandenberg Polymorphisms Slide 55 Molecular markers Resolutionpower Resolution power RFLP, Restriction Fragment Length Polymorphisms (high) SSCP, Single Strand Conformation Polymorphisms (very low) RAPD ( (random amplified polymorphic DNA) RAPD (medium) (random amplified polymorphic DNA) AFLP (Amplified Fragment Length Polymorphism) Multi-locus fingerprints Microsatellites (SSRs) Sequencing (SNPs) Slide 66 DNA 의 다형현상 (DNA Polymorphism=differences) 개체간의 DNA 의 차이를 DNA polymorphism 이라 함 DNA 염기서열을 분석하여 개체간 특성 파악 제한효소 절편다형 (Restriction Fragment Length Polymorphisms, RFLP) 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) 임의증폭다형 (Random Amplified Polymorphic DNAs, RAPD) 초위성체에 의한 다형관찰법 (Simple Sequence Length Polymorphism, SSLP) Slide 77 Molecular differences can be caused by: – INSERTIONS Johnny is a boy Johnny is a bad boy –DELETIONS The cow jumped over the moon The cow over the moon –MUTATIONS Bean Been These may cause phenotypic differences 왜 DNA 의 다형현상은 일어나는가 ? Slide 88 T-T-G-A-C-T-A- C -C-C-A-G-A-T-C I I I I I I I I I I I I I I I A-A-C-T-G-A-T- G -G-G-T-C-T-A-G T-T-G-A-C-T-A- A -C-C-A-G-A-T-C I I I I I I I I I I I I I I I A-A-C-T-G-A-T -T -G-G-T-C-T-A-G E. coli isolate A E. coli isolate B DNA 의 다형현상 SNP(single nucleotide polymorphism) Slide 99 Slide 1010 Restriction Fragment Length Polymorphism –1980 Botstein et al. polymorphisms due to changes in restriction sites or in DNA between sites 제한효소 절편다형 (Restriction Fragment Length Polymorphisms, RFLP) Slide 1111 Restriction fragment length polymorphism Co-dominant Requires: –single copy DNA probe –Restriction enzyme –Southern blotting –DNA polymorphism RFLP Slide 1212 Polymorphism -Parent 1 : one band -Parent 2 : a smaller band -Offspring 1 : heterozygote = both bands -Offspring 2 : homozygote parent 1 Polymorphism Parent 1 : one band -Parent 2 : no band -Offspring 1 : homozygote parent 1 -Offspring 2 : ???? P 2 P 1 O 2 O 1 Gel configuration Co-dominant marker P 2 Gel configuration P 1 O 1 O 2 Dominant marker Slide 1313 Inheritance of RFLPs 자손에게 유전 Slide 1414 RFLP probe RFLP linkage analysis RFLPs provide useful markers for all of the human chromosomes disease genes can be mapped by searching for linkage between an RFLP and the disease phenotype disease gene A a normal gene AA Aa aa AA homozygous for ‘A’ Aa heterozygous aa homozygous for ‘a’ the A/a polymorphism is linked to the disease-causing gene In a dominant disease, AA and Aa would be affected In a recessive disease, AA would be affected and Aa would be a carrier Slide 1515 Aa Aa aa aa disease gene A a normal gene mother affected child test subject the test subject is determined to have the same genotype as its sibling and therefore can be predicted to get the disease the prediction must be qualified, however, because of the possibility of recombination between the polymorphic marker and the disease gene the frequency of recombination and therefore the reliability of the marker is dependent on the distance between the two sites X recombination? RFLP probe father Slide 1616 Genotype Determination using RFLP's and a Gene Probe A DNA probe that hybridizes to the 5' end of the human beta globin gene (shown in blue on the diagram below) was used to identify RFLP pieces from members of a family in which sickle-cell hemoglobin (HbS) was segregating. The normal HB allele (HbA) is cut at three places by a particular restriction enzyme (positions shown with red arrows). The HbS mutation destroys the internal restriction site so the HbS gene is cut in only two places. Thus, the probe hybridizes to a 1.15 kb DNA fragment from HbA DNA and hybridizes to a 1.35 kb fragment from HbS DNA.restriction enzyme Slide 1717 P1 P2 Restriction sites e.g. EcoR1 recognizes GAATTC and cuts between G and A  Slide 1818 23 KB 9.4 KB 6.7 KB 4.3 KB 2.3 KB 2.0 KB 0.6 KB DNA taken from three individual animals, cut with a restriction enzyme and separated by gel electrophoresis... Slide 1919 homozygote heterozygotes Autoradiograph of Southern blot produced from previous genomic DNA restiction digest, probed with a muscle actin gene probe... DNA polymorphism: 3 different “genotypes” Slide 2020 RFLP DNA cut with restriction enzyme, separated by size on an agarose gel, hybridized to a filter To see bands, probe with a labeled fragment of DNA –probes = genomic clones, cDNAs, ESTs –Labeled with 32 P or fluorescence Slide 2121 RFLP techniques Slide 2222 P1 P2 P1P2F1 F2 Transfer to a membrane Probe with DNA fragment Southern Hybridization Slide 2323 P1 P2 P1P2F1 F2 Slide 2424 P1P2 자식들 부모 Slide 2525 RAPD Random Amplified Polymorphic DNA –Williams et al. 1990 Amplify fragments of DNA using a SINGLE, RANDOM oligonucleotide primer (usually 10mer) Run out product on agarose gel, stain with ethidium bromide and visualize using UV Polymorphisms due to differences in and between primer annealing sites 임의증폭다형 (Random Amplified Polymorphic DNAs, RAPD) Slide 2626 RAPD Domimant markers Reproducibility problems Amplifies anonymous stretches of DNA using arbitrary primers Fast and easy method for detecting polymorphisms Random Amplified Polymorphic DNA (RAPD) Slide 2727 Random Amplified Polymorphic DNA (RAPD) Strain 1 Columbia Strain 2 Landsberg Strain 1 Columbia CCGTACGTAGCAAGT-.....NNNNNNNNN___...ACTTGCGGCGTA CL C C/L C C/L LL PCR products on agarose gel parental DNA mapping population CCGTACGTAGCAAG G -.....NNNNNNNNN___...ACTTGCGGCGTA GCCGTAGCAAGT 5’5’ 5’5’ 5’5’ 5’5’ 5’5’ 3’3’ 5’5’ Primer Strain 2 Landsberg 순수 혹은 잡종분별 Slide 2828 RAPD Polymorphisms among landraces of sorghum M Sequences of 10-mer RAPD primers NameSequence OP A085’ –GTGACGTAGG- 3’ OP A155’ –TTCCGAACCC- 3’ OP A 175’ –GACCGCTTGT- 3’ OP A195’ –CAAACGTCGG- 3’ OP D025’ –GGACCCAACC- 3’ RAPD gel configuration Slide 2929 Microsatellites (SSR) polymorphisms in the number of di-, tri-, tetra- or penta-nucleotide repeats scattered throughout the genome Often arise due to ‘ stuttering ’ during DNA synthesis or uneven pairing and crossing-over primers designed based on flanking DNA sequences –Requires large amounts of sequencing to develop - $$$ 초위성체에 의한 다형관찰법 (Simple Sequence Length Polymorphism, SSLP) Slide 3030 AGTGCATGAGCGCGCGCGCGCGCGCGTCTCTATGTC AGTGCATGAGCGCGCGCGCGCGTCTCTATGTC S R SRR SRSRS R S Parent 1 - resistant Parent 2 - susceptible Slide 3131 Microsatellites (SSR) PCR products run out on agarose gels (if not too close in size) or more often, on polyacrylamide gels (if only a few bases separate the 2 genotypes Visualized by using labeled primers (radioactive or fluorescent) or with ethidium bromide or silver staining Slide 3232 Sequence GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGAT TCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTG GCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGA ATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGT AAGAAACCTCTTCCTGTTAG ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCT GCTGTGGAACCA….. Repeat GGT(5) SSR repeats and primers GAGGGCTGATGAGGTGGATA ATCTTATGGCGGTTCTCGTG Slide 3333 AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGG P1P1 AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCG P2P2 P1P1 P2P2 SSR polymorphisms Gel configuration Slide 3434 Genographer image of microsatellite sORB30 in a B. napus population P2P1 bp 207 169 sORB30 Agriculture and Agri-Food Canada Slide 3535 Simple Sequence Length Polymorphism (SSLP) Strain 1 Columbia ACGT GA (GA)44 GA CCTG Forward Primer Reverse Primer ACGT GA (GA)78 GA CCTG Strain 2 Landsberg Strain 1 Columbia Strain 2 Landsberg PCR Forward Primer Reverse Primer Slide 3636 범인 1 범인 2 희생자 Slide 3737 엄마형제자매 ? 엄마형제자매 ? Slide 3838 Slide 3939 Slide 4040 ABI 377-96 microsatellite mapping gel Agriculture and Agri-Food Canada Slide 4141 Slide 4242 Theory: the conformation of single-stranded DN A is dependent on its primary sequence Purpose: to electrophoretically separate PCR fr agments that differ by a few bases. PCR hypervariable fragment of gene. Denature into single-strands by heating. Run on a polyacrylamide gel PCR products with different sequences will ru n a different speeds on the gel. 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) ( 교재 136-137) Slide 4343 Single strand conformation polymorphism analysis (SSCP), takes advantage of the secondary structure (conformation) of single stranded DNA. A mutation in a DNA strand may change the conformation of that strand. The mutant conformation may electrophorese differently to the wild type conformation. 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) Slide 4444 DenatureRenature rapidly Wild type Mutant 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) Slide 4545 Wild type Mutant Electrophorese ss DNA ds DNA WTM 단이가닥 입체다형 (Single Strand Conformation Polymorphisms, SSCP) Slide 4646 PCR- SSCP analysis of the second exon of the goat MHC class ll DRB gene PCR products were denatured at 80°C for 5 min and immediately chilled on ice for 2min. The samples were run for 3.5hrs on 10% polyacrylamide gels in 1% TBE buffer at 100V and the bands were visualized by ethidium bromide under the UV light. Recipient blood Donor cell line NT kid blood (Jinsoon) Slide 4747 SNPs (Single Nucleotide Polymorphisms) Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs. Many SNPs have no effect on cell function and therefore can be used as molecular markers. Hybridization using fluorescent dyes SNPs on a DNA strand Slide 4848  SNPs, the most common form of genetic polymorphism causing diversities among different individuals.  SNPs are estimated to occur every 500-1000 bp (3,000,000 to 6,000,000 SNPs)  To facilitate large scale genetic association studies  Approximately 1,000,000 human SNP’s currently mapped  Useful in pharmacogenomics, advanced disease screening studies, etc… SNP (Single Nucleotide Polymorphism) Slide 4949 SNP Analysis SNP Discovery: Direct sequencing and comparative analysis –Quality Values –CEQuence Investigator SNP Scoring: Rapid identification of known SNPs by microsequencing or primer extension –CEQ or SNPstream Analysis –Primer Extension chemistry Slide 5050 DNA polymorphism 분석에 의한 동물육종 개체에 의한 유전자형을 손쉽고 정확하게 파악하여 개체에 대한 육종가 추정 대동물에서 착상전 수정란의 성감별 유전병 등 열성형질을 제거하기 위한 종축집단 구축 육종 프로그램내의 혼선을 방지하기 위한 개체나 집단간의 혈연관계 확인 형질관련 유전자의 분리를 위한 도구로서 유전자 지도 작성시의 이용 Slide 5151 Marker Assisted Selection Breeding for specific traits in plants and animals is expensive and time consuming The progeny often need to reach maturity before a determination of the success of the cross can be made The greater the complexity of the trait, the more time and effort needed to achieve a desirable result. Slide 5252 The goal to MAS is to reduce the time needed to determine if the progeny have trait The second goal is to reduce costs associated with screening for traits If you can detect the distinguishing trait at the DNA level you can identify positive selection very early. Marker Assisted Selection (MAS) Slide 5353 Developing a Marker Best marker is DNA sequence respons ible for phenotype i.e. gene If you know the gene responsible and has been isolated, compare sequence of wild-type and mutant DNA Develop specific primers to gene that will distinguish the two forms Slide 5454 Developing a Marker If gene is unknown, screen contrastin g populations Use populations rather than individual s Need to “ blend ” genetic differences between individual other than trait of interest Slide 5555 Developing Markers Cross individual differing in trait you wish to develop a marker Collect progeny and self or polycross the progeny Collect and select the F2 generation f or the trait you are interested in Select 5 - 10 individuals in the F2 sho wing each trait Slide 5656 Developing Markers Extract DNA from selected F2s Pool equal amounts of DNA from each individual into two samples - one for e ach trait Screen pooled or “ bulked ” DNA with what method of marker method you w ish to use Method is called “ Bulked Segregant A nalysis ” Slide 5757 Marker Development Other methods to develop population for markers exist but are more expen sive and slower to develop Near Isogenic Lines, Recombinant Inb reeds, Single Seed Decent What is the advantage to markers in breeding? Slide 5858 Slide 5959 Capillary Electrophoresis: The Basic Design 1.Dideoxy-terminator labeled fragments are heated in plate to denature. 2. Current is applied across the capillary, and charged fragments are drawn into capillary. 3. Fragments migrate according to size through capillary. 4.As fragments pass detector window, diode lasers excite dye terminators. 5.Dye terminators fluoresce. 6. Filter wheel masks spurious signal. 7. Filtered signal excites photomultiplier tube (pmt). 8. Software interprets signal and calls bases 3 2 1 Slide 6060 CEQ Applications: 1)Fragment Analysis STR/SSR/Microsatellite Analysis Amplified Fragment Length Polymorphism (AFLP) Random Fragment Length Polymorphism (RFLP) Loss of Heterozygosity (LOH) MI (Micro satellite Instability) SNP Genotyping Gene Expression Other sizing, peak ratio/quantitation applications 2)DNA Sequencing Short PCR (75 – 300 bp in 25 minutes) Long Fast (700 – 900 bp in 80 minutes) Extended Read Lengths (increase reads by 20% - over 1000 bp) Slide 6161 Benefits of Optimization with CE: Can modify methods –For high signal = inject less –For low signal = inject more –For short template = decrease separation time –For longer template = increase separation time –Re-run samples at many different methods (with limitations!!!!) Slide 6262 CEQ 8000 Series: Hardware Fully Automated Slide 6363 Perform sequencing and fragment sizing applications without changing gels, capillaries, or plates! CEQ TM One Gel, One Array, One Software Capillary array- patented fixed coating eliminates electrosmotic flow (EOF) Gel cartridge- preloaded syringe, linearized polyacrylamide (LPA), nontoxic Slide 6464 CEQ TM Well-Red Dyes- Designed for CE Minimal spectral overlap superior resolution Infrared dyes low intrinsic background with no interference from biological components Similar sizes and mobilities move optimally in a capillary array Slide 6565 Slide 6666 Heterozygosity: the status that the two copies of a gene or non-gene segment at a locus have different sequences Loss of Heterozygosity (LOH) Cancer Research Heterozygous PCR CEQ Slide 6767 Abnormalities (deletions) through mutagenesis Loss of Heterozygosity (LOH) in Cancer Slide 6868 Slide 6969 AFLP (and RFLP) reveal the DNA fragment length polymorphisms due to mutation at restriction sites or any insertion or deletion between two restriction sites. Amplified Fragment Length Polymorphisms Why Use AFLP (or RFLP)? Rapid analysis of unknown genome without sequence knowledge Identification of different species Relationship study Genome wide genotyping High discriminatory power and relatively easy to perform. Slide 7070 AFLP Theory AFLP: A mplified F ragment L ength P olymorphism –Mutations at restriction enzyme cutting sites result in fragment length polymorphism –Ligation of adapters to genomic restriction fragments –Selective PCR amplification with adapter- specific primers Adapters and amplification w/ selective primers are the keys in AFLP Slide 7171 AFLP -How It Works: Fragment length polymorphism due to: –Mutation at restriction sites –Insertions or deletions between restriction sites –Mutation adjacent to restriction sites and complementary to the selective primer extension Slide 7272 Slide 7373  SNPs, the most common form of genetic polymorphism causing diversities among different individuals.  SNPs are estimated to occur every 500-1000 bp (3,000,000 to 6,000,000 SNPs)  To facilitate large scale genetic association studies  Approximately 1,000,000 human SNP’s currently mapped  Useful in pharmacogenomics, advanced disease screening studies, etc… SNP (Single Nucleotide Polymorphism) Slide 7474 SNP Analysis SNP Discovery: Direct sequencing and comparative analysis –Quality Values –CEQuence Investigator SNP Scoring: Rapid identification of known SNPs by microsequencing or primer extension –CEQ or SNPstream Analysis –Primer Extension chemistry Slide 7575 Life Cycle of a SNP CEQ 8000 and 8800: 1 – 4,600 SNP’s SNPstream: 4,600 – 800,000 SNP’s Slide 7676 Primer Extension Technology: The Genotyping Gold Standard Detect function Anneal: Simple Primer Extension Extend: Accurate “lock and key” enzyme Detect: Fluorescence Slide 7777 Primer Extension Technology Slide 7878 Multiplexed SNP’s on the CEQ 8800 Slide 7979 Manage genetic study data including genotypic, clinical, and phenotypic information and pedigrees. Create and view customizable, interactive pedigrees. Explore genotypic and phenotypic patterns with advanced visualization tools. Perform population statistical analyses including allele and genotype frequencies, Hardy-Weinberg equilibrium, and chi-squared analysis.